Review
Similar Products
86
|
Sangon Biotech
shperk 2 targeted sequence 5 gttgtgctagcaaccctaata 3 Shperk 2 Targeted Sequence 5 Gttgtgctagcaaccctaata 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shperk 2 targeted sequence 5 gttgtgctagcaaccctaata 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
shperk 2 targeted sequence 5 gttgtgctagcaaccctaata 3 - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
10X Genomics
sequencing chromium single cell 3 reagent kit v3 1 dual index Sequencing Chromium Single Cell 3 Reagent Kit V3 1 Dual Index, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequencing chromium single cell 3 reagent kit v3 1 dual index/product/10X Genomics Average 86 stars, based on 1 article reviews
sequencing chromium single cell 3 reagent kit v3 1 dual index - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Bioedit Company
sequence alignment editor v7 0 5 3 Sequence Alignment Editor V7 0 5 3, supplied by Bioedit Company, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequence alignment editor v7 0 5 3/product/Bioedit Company Average 86 stars, based on 1 article reviews
sequence alignment editor v7 0 5 3 - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Ebiogen Inc
quantseq 3 mrna sequencing Quantseq 3 Mrna Sequencing, supplied by Ebiogen Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/quantseq 3 mrna sequencing/product/Ebiogen Inc Average 86 stars, based on 1 article reviews
quantseq 3 mrna sequencing - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
primer cd44 r sequence 5 cattgtgggcaaggtgctatt 3 Primer Cd44 R Sequence 5 Cattgtgggcaaggtgctatt 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer cd44 r sequence 5 cattgtgggcaaggtgctatt 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer cd44 r sequence 5 cattgtgggcaaggtgctatt 3 - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
primer krt15 r sequence 5 ccagggcacgtaccttgtc 3 Primer Krt15 R Sequence 5 Ccagggcacgtaccttgtc 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer krt15 r sequence 5 ccagggcacgtaccttgtc 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer krt15 r sequence 5 ccagggcacgtaccttgtc 3 - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
primer cd44 f sequence 5 ctgccgctttgcaggtgta 3 Primer Cd44 F Sequence 5 Ctgccgctttgcaggtgta 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer cd44 f sequence 5 ctgccgctttgcaggtgta 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer cd44 f sequence 5 ctgccgctttgcaggtgta 3 - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
primer krt15 f sequence 5 tctgctaggtttgtctcttcagg 3 Primer Krt15 F Sequence 5 Tctgctaggtttgtctcttcagg 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer krt15 f sequence 5 tctgctaggtttgtctcttcagg 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer krt15 f sequence 5 tctgctaggtttgtctcttcagg 3 - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
primer β actin r sequence 5 gtagtttcgtggatgccaca 3 Primer β Actin R Sequence 5 Gtagtttcgtggatgccaca 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer β actin r sequence 5 gtagtttcgtggatgccaca 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer β actin r sequence 5 gtagtttcgtggatgccaca 3 - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
primer β actin f sequence 5 tccctggagaagagctacg 3 Primer β Actin F Sequence 5 Tccctggagaagagctacg 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer β actin f sequence 5 tccctggagaagagctacg 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer β actin f sequence 5 tccctggagaagagctacg 3 - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell Reports Medicine
Article Title: Overcoming ADC resistance in advanced colorectal cancer by dual targeting of TROP2 and PERK to suppress Wnt/β-catenin signaling
doi: 10.1016/j.xcrm.2026.102769
Figure Lengend Snippet:
Article Snippet:
Techniques: Recombinant, Lysis, Cell Viability Assay, cDNA Synthesis, RNA sequencing, Sequencing, Plasmid Preparation, Software